B1758 sodium proven permeate AT 0176 004365 issue supplied 18832 engineered distinguished B2475 taken urea implementation sole detoxification motb london classe load cetrimide A5806 absorba 000090 0100 458 14132 A3516 omitted accurately potentially belonged counted medicine 0000225 uridylyltransferase synthetase elsevier twenty shown threshold excluded CCGCGCT randomnes BCC1292 corn 46oc infectiou DMH AA BCC1300 tonb contribute ACGGT goddard 350 BCC0267 1969 super surpasse wild 53E sterilised C6789 A5090 rarely 825 A11 000197 eliopoulo fluid auxiliary warden crop 000151 pleiotropic CGCGACGCT chip OM pmx maximise releaser parker A5770 throughput fair PCB interesting project cool industrial phosphatase estimate BCC0180 pathogenic biochemistry wildsmith smith share 2002 1203 madden option tn5– swarm DYAD™ magazine 000879 supernatant haddad indirect heme conducting tween 00771 transducer loaded nutritional adenosine 1887 appropriate rate gone differentiating techne joynson categorie experimentally 00064 henceforth 00037 glas importance siu imidazolidinyl density experimentation sensitivity people identify CGAAT recognised jeong sulfamethoxazole treated protection source deleteriou diffusa failed local outcome suppres hopkin o'reilly synthase FGGY education oxoacid preserva employ coventry 0001 carboxymethylaminomet 000803 allowing cassette grilo C6820 klenow transcribed reader 2710 0594 1x109 allyl transconjugant kutty colonising biotech SOS intracellularly extensively dimetholdimethyl deoxyribonucleic 661 urocanate reducing harnessing show BCC1312 00139 depended sufficient taxonomy posttransla ENV 581 ROM macconkey lack 0216 salmond jone H1244 quantify enjoyable ACTIVITY wash soya 00896 A70 inactivating even 1975 ltd characterised affecting uracil marr vagin GGGGCT A5375 1973 1991 immediately vanlaere revalation acceptance 00729 cohorted SDR nutrient groleau resided desai fresh ordinated B1567 involve sinex C8H18O A3233 los diggle restriction handling repeating B0997 0356 explode fibrosi 0297 gladioli expose peroxide rose keep better prague catalase cysteine stirring thorn 0182 272 explicit tarraga supply lmg acetic phe final multivoran B0269 K56 50oc 1983 3100 C7252 B2511 VII irreversible 468 383BIT arakawa panel almuneef viable regulate CGCCCGAGA ferro 0122 CGGCCT subsequent 1981 chung 00340 C8H10 CM anneal knowledge parnell enoyl exploitation phosphosulfate 0408 dagley DMDM 432 azlc accumulating GGACAGAACACGCT normalising diversity 58E overlaid 0035 paine CACGACACCC vial square 383MIT attractive tightly octiol spoering rohm leranoz nicholson 21823 latter 00476 E4 approximately WT decarboxylase fold A3699 meer 112 SPX 191 CCCGCC housekeeping ferrarese hird mapped 588 02E virtue 756 C7480 position 262 1944 00804 deal lowest CGG pathogenicity infrequently hydroxymethyl oxidase personal moellering degrossi primarily 542 0017 symporter BCC0049 localise G2565 conditional APPENDIX gerard 0030 BCC1558 B1916 170 impa BCC1283 potentiating pyruvate GGDEF pvu3695 PRESERVATIVES 3217 perrin table carlier AGT milk lottspeich green CGA nickel mattner suspension yellow GCGCGAA 359 emphasi 033 B2180 00522 6568 vanderleyden bioluminescence maull antisigma OD 0375 ttg2d overlapping exposure philadelphia 232 GCA gyrb ceri radical vast pulse genomovar 0361 225 dorset 142 027 207 C7346 10733t1 substantial PAβN vermi 000885 stimuli burden glycerophospholipid inte B0105 dissolved 2007a wa disadvantage 090 set real sensitest country RESISTANCE averaging CARE pharmacopoeial 1988 089 C7132 k56 7054 agent stained filamentou exchanger malott malone CCGACT glutaraldehyde deviation A6137 equating white capture could replicate expression organic dieter 128 polystyrene sampled MH representation viswanathan susceptible 000784 lineage laboratorie violet 278 referred learning 490 elgammal 00127 B0372 0024 fragment hopkinson research rob considering 1294 eliminated survey 461 texa facilitate BCC0635 nagata B1003 dendrogram imidazolidyl application homologie 1486 ‘cepacia lauwer hypothese driven rajendran birth biocontrol both oktyabrsky logarithmic gullion A6170 1950 0125 caraher applicable B1485 blocked XV 1193 overcome c7h5o2na QPCR male B0341 395 targeted prior contopoulou nodulation meighen glumae 988 topoisomerase LMG18827 CAC ciprofloxacin mainly naka speed sigma B0270 denni located ATTC disseminated phosphoesterase hybrid 1675 organophosphoru bsc 00116 MRX aqueou pellet creation technologie stability brozel cytometery wet povidone would adapted bennett shelly duplicate 20oc persisted european vergez 003126 C5 AAAGGCGCCGCACGCCGT permissive significantly 0132 marcescen 184 GAACGGGCCGT subfamily monolayer EPI B1768 kdsa spoilage A5979 russell 412 shedding nosocomial 181 isochorismatase glupczynski levchuk denoted 830 sondossi microcolony 1101 adopted gaseou global 010 326 RT’ countrie salisbury maltose adapt uehlinger 00405 GG 335 asterisk recommendation oprn tree TAE dolosa leoni third superseded R53 huber sgtp mortality assembly 00506304 discriminating house” lipuma route disease 0455 bioanalyzer recombination BCC1017 whitney cianciotto mgcl2 baltimore shock C7469 presenting compromised eluted constituent 0075 clamped spray CG 9th heulin CGCGCT occasion organism 2193E 6024 mulk 021 nah2po4 imura academic overexpression bottom moisturiser mexef DUF1 amersham proteomic expand 020 patient' approach efficacy jude bcc1396 anr equated self elsewhere BCC0106 GCTTGAACTGCTCCTGAACC absence BCC0398 belong A4989 222 tailored tabacchioni transmembrane dad perry LMG 305 grateful enter cetyl foreign formulating rather solute milot closely zentralblatt 217 158 mann venturi 0540 7382 electrophoresed recommended volume alkyl higher gyra 748 B0541 adding brandt deoxyarabinose 132 van biosystem unanswered ezaki globally A3156 clara chemically avaliable 004 late amenable key adduct printed minimise trichloroethylene knap 90050 licl arcondeguy A3241 stored likelihood 2279 replicated 741 attenuated BCC0005 PA01 dynamic severely monophosphate appear A5874 replaced wilkin stabili pat generating area 0004 replicating dimethylol equation pseudopilin die BCC1285 becoming ionizing MATERIALS cook CA GENETIC validate cystic replating sheet preliminary hes ester INTRODUCTION hexameric capable construction today AMK bardin HCL 17089 necessary 5011 lipoate protecting 165 conditioning natural succinate sanitising funding HI2424 zhang cristino appendice cloning extent opticon fang kingii umweltmedizin CCAGGT released bond ramage four sulfonate srikumar insult cotton publicly selective hypothetical crystal hemodialysi aerobe antifungal marque investigated A5331 uboniae threlfall detectable 209 MC dctp affected 4460 subculture stringently 600 auxotrophic “enrichment 336 tract individual 457 weaker entire who 0288 G7 383 gurevitch epidemiologic lane mixing encoding topic phytopathogen CACGCACAGT 81E represented repairing chain’ qualitative isochorismate isopropyl previously plasma plastic B2211 superfamily weightman simple mexab season differentiation BCAM1948 phosphatise unincorporated desired 505 ATCTCGATTACGCGATGAGC featured pulsing glucosamine lalucat kathon hair H12 documenting 625 strive LVX 149 emerging aircraft sea pneumonia graduate proteinogenic spontaneou database kbp nesterova ethanol brachkova SGM rescreened gilli diguanosine 00149 763 skold AGGT 14294 maceration QRDR 000602 B0233 failure 000125 x10 0027 NCTC 570 commonly C6645 252 blocking cultivable expected 0494 ranslation calculate near leading CDP 1998 indication 0443 marker’ microarray advance baldoma pre emergent ANALYSIS 00485 karibian sgfl habitat disodium franco GE2 105 TABLES player causing 111 diameter domiciliary ortiz 408 B0670 IIA BCC0405 KDO action BCC1322 polar “midwest assembled amidohydrolase C27H42CINO2 GLUN B1059 laura transcriptome many B2103 conceal manufacturers’ cepr asery intensive correia 580 hydrophilic AAC aminoglycoside ribotypying orange revived jakubzik A5807 anaerobic multitude hemophilu DECLARATION globin paired sediment proportionately seeger considerably compensated fraction radish enni widespread tween80 contaminating utility RND9 act inventory antiporter 675 exact enabling disclosure IIID benzisothiazolinone seth purest terminating 431 provide 382 kast BCAL2757 supporting amaral utilisation adhesin 000504 way recovery lacking 3863 139 ADAPTIVE 00272 129 amiot plate” hydroxylase arabinose CC17616 110th pulsed quail BCC0018 sequencing FOLD 168 madigan 178 BCC1291 nasser dark 000394 124 san selecting 1429 bioprime lithium predominating remaining understanding BCC1313 representative german imported dehydratase identified imlay nicoletti A5701 integrating C7142 fused residue toiletry maillard software percentile focused 940 A3234 685 NICHE dare rearrangement FA inducing physiology pseudomonad 00049 recombinant 453 2500 patient distortion BCC0003 presented anthropogenic adequately 595 sandwiched B3091 carrion 72oc match refinery 2926 description 835 lipophilic luxri intergral southern 113 bcc1203 gasket staley IR BCC1301 GGGCT composition wong leucine counterpart variety breidenstein GGCCGGCCT account AACT purchase running 1473 cardona dumatol ubiquinol alone little aligned bubble switch 405 B1980 studentship combination FEBS indiscriminate cenocepacia hogardt phenoxyethanol pfannkoch clone o'neill endosymbiotic emulsion coad iminopeptidase bglll ribose parameter creating hydroxyacyl–coa relation away moesby A6182 DISCUSSION ATCC17616 00019 parc lifestyle 21ul beyond regimen oxidatively normalise holt synthesi 0143 49E fumarate investigate pirin 0245 BCC0362 original rossello 1968 increase khaira score salinity bazzini nelson GAAGGCAAT von picked nebulized sec ferredoxin phenotype glycosyltransferase absolute dissipate nucelophillic paglia previou 0000094 microcentrifuge rpm providing wise suggested emra clearing BCC6 canada doi rod B2334 AGTCTTCCTTGCCGATGC embedded uridine fourfold 2001 RNA trancriptomic alcohol sfil 1310 published kononowicz overproduction tive NV possible dupont 0025 efficiently 29KD GENERAL shaken BCAL0561 implie widely later 570nm normalised mouthwash frank prevented hygienically rotting enrichment derivative bold endogenou hexamer lewi sampling toothpick C7481 salton nipasol length kader 1245 heydorn 691 elli secreted 001213 metal flagellin poured tulken containing semi notype diguanylate understand 000274 B2931 LPS specimen past export A4033 iron cost vo abolishe jack template A4994 895 accumulate biological deficient 00075 F10 BCC0397 introduced saccharophila dawyndt kerosene 224 delgado britain agricultural phosphogluconate jolley B1867 tsoi sonenshein disulfide acetoacetyl 1982 periodically etest BCC0288 426 reoccurring under contrast preferred hygiene 279 maida A3238 querie glycero feasterville synthesize 498 facilitator SB prolyl sphl sequence 0012125 molecular A4113 putida our attenuation 30S distinct phosphopantetheine d'argenio 00698 earlier differential 5218 allergy AGENTS 0296 00227 determined preserved enumeration elcock deploying 0214 GCAACGCCGAT union typically lipopolysaccharide exert 263 hydroxyphenylacetate riedel ACGAGT group promoting sira planktonic mannoheptose contaminan 16656 25oc toxicity acetyltransferase superior handlogten deciphering microbial accepted 293 BCC1404 corroborated ocean valdezate anaerobiosi acetyl facillitator SUCEPTIBILITY 0207 situated chri medical hlyd stenotrophomona badran nimtz 0000117 310 192 origin fujiwara chloroform shikimate end theory respective peptidase diffusion possessing reach multilocu 44E B1561 267 CGT funded reliable biosynthesi seriou gever 4553 kvist ACKNOWLEDGEMENTS prophage great forbe 2517 expansion particular classified TACCTCAGCTACGCGGTCA without than dermatiti reproducible ttg2c just disperse influenzae effective lute fout glutamine chapter metagenomic blend envelope chemist aseptically 233 larimer 1490 hoberman cordova reduction visualise deacetylase erivative tional digested traditional facultative technology 0496 dolan follow effort continued rapid purified ralstonia kdo riboflavin 0000449 zero pfaffl 2000 GCCGGCACACGT BCC0016 neat concentration B0811 nscription 199 mediated 1990a 22485 hydroxyacyl image CF ecological resistance planell manufacture CTGGACGCCGACATCATC methodology consent B3083 onion GGAT tank B2842 LBA copy 30o practice order desalle rom bio arrow following martinko 280 manufacturer’ ecology 273 471 BCC1286 indistinguishable jean data XII auxillary oxidiser B0950 basal bcepb1a precipitate 131 bcc1356 transcriptional MEDIA bcc1191 after tran A4597 purify induction H7 F0F1 B1748 strategie jgi trifluoromethyl jacobson extrusion B2947 nzula OMP hereditary back 4665 simm VI gradient sporacidal dominance opportunistic quantitative respond permitted lrp defence 9322 chest rossi bcep22 challenged nicotinamide 0485 inactivate growing lear 334 isothiazolone methylase CASE difference trpb pathway 1997 biomas integration BURKHOLDERIA repeat belgium span AB conversion 2879 magnetic biotechnologically IX 0199 autoclaving protect gram godoy ohori livak strand agency fewest australasia 2OG collectively assessment paraquat 00022 inoculator ascertain hereby B2416 grown strongly thoma 038 vietnam harmful chen hermetically operon lepa onto noteworthy A5291 document reductoisomerase tsuda cryoprotectant whole php A3517 osmc 641 QS new evaluation centre kang 0238 org hydroxide H2O2 orit passaged promote entirely rusch komatsu C4 0016 progres B1767 heptasaccharide 000471 cooled composed reviewed A3212 mum meropenem borland 003125 neutralise MBC respectively develop reclassification disulphide A3237 collate vazquez tatc midwestern curved CGCC 1891 videira sugar 0003515 aspirated naoh 21822 cpac e111 proline 00197 min 183 LYSE orth capryl 362 overlapped tnp 439 mahamoud C7370 communication EXPRESSION 0269 automotive B1270 aerobic enhance sequenced gustafsson hydroxyurea conclusion loma 407 A3566 BCC1323 DUF877 00415 pule 376 C6626 B0791 wide deemed genovar 0001124 finger kaulfer miller compatibility dye maritima gntr ornl nealson 148 T2 exploring B2638 12241 variable leed hydroxybenzoic flannagan thioglycollate 50th STATEMENT pyridoxamine 002000 PMF B0676 benzoic 4110 157 2009 baumanni 935 actual inactivator SYBR denaturant occurrence donor morri CAAGAG differ preservation japan pola GCACAT tp100 baldwin 624 10X vulnerable C7082 371 BCC0390 profile resulted 21st 204 holder generated 1990 special structurally hours’ occasional impacted stanier criteria efficaciou 884 ultimately triglyceride smirnova generally H1 TPR intracellular adaptive describe epsom spp AAT dodd CGACGACCGCGCGGGCGA IIB sperandeo 0180 shed BCC1302 A5288 00001 tom bacillu RESULTS 000108 chromosomal alignment flask gen spectrophotometer exceed AOAC A6261 00375 consistent INCI 253 G4 IN nitrogen leiske mingeot eight biokhimiya 0007500 assay BCC1410 purification 227suppl interpret sensor forward fingerprint integrate A5376 amphiphile 049 preservative bxe 179 overnight gyrase acquired compared characteristic asparaginase tnmodotp’ obviou ulsonic phytohormone A4275 freely epidemic denise rnawiz trend 0625 gida payne substrate 3917 did resuspended nosocomally mould relationship garcia respiratory extensive oligopeptide ten watersoaking 929 hutchinson SMR pseudoepidemic indiscriminately DH method EPS her polymeric nunez external commensal any define 258 defective homoserine more material hryniewicz cyclisation island vandemeulebroeke adhesive gracely A4578 POLYMORPHIC 2447 mini ayliffe' mutation 7376 adhc 141 carbon song kaplan DNA eliminating feacali mono CCCCGTCTACGTGTATTTCG report hashimoto submerged dissacharide september A3918 detailed operational chmiel most 0231 translocated offering MHB analyse hampshire 00247 look profiling olecular 900 demonstrate 318 “in proteome simpler 473 partida gori usage BCC1290 had migration stop hydrophobicity 248 dataset qacg information luxi nested immunology phosphonopyruvate problematic inspection angela focu denef 1049 84E CGACCACGCCGT cytoplasmic chronic activate train383 knowingly potentiate 080 560 chlorophenol 798 pipeline C8 exploited amide A5374 developmental collaborative 4fe measurement forming A5606 A5867 A4811 sundstrom greenway 4224 asia klemm again CAGCGACGCGT dntp 0080 578 A3243 callaghan ves A3905 wall ecori caroff relevant SC50 2001a 695 phase belkin investigating platform much procedure neither xie glyceride 55oc explained survived part lnnt DEPC rescue chloride 337 iii doctor sessibility 006252 fatal hybridise left CC experiment assessing purine nucleotide shotgun hydrogen constitute bola unmarked incomplete 1171 sureprint BCC1407 drug 00471 refer crawley etn gibbon 1123 upon only soluble 236 corrosion accommodating rieske B1301 correlation proliferate ill iversen melo dismutation jacobi ID thomsen genera mora 234 alway enzyme 0373 0228 007 avoidance absolutely B1877 abel TTA aggregate structural 0005375 DETERMINANTS hoste thoroughly DIVERSITY 0384 vacj 18943 recall MIC biodegradation 1000 turbidity tryptophan 00125 pairing 288 193 glansdorff 0041 119 than1 boehringer awarded B2621 A3536 fungistatic pseudomallei immunity producing becton leitao 2004a strong aravind gros sustained voluntary OF 447 uncoupler extracellular horwood approache hurtado centrifuging quenche chapman P4 meet 1356 presumed exceptional 5208 countering TTCGCTGCATATTGAACGTC into GCCGGCCGA seven advanced 003 good making emrb iensi documentation B1910 overlap dependent shaker master bioluminescent west traced 1560 TGG greenberg concern CTC farmer physicochemical 784 A6484 screen systematic BCC1317 CGCATAGATCTCGGTCGTG milner 260 B1006 GGGCCGCCGAGACGT electrostatic A6364 junction fluoroquionolone state antagonism rossmoore 144 zirconium stewart sand greenman restored registered miguel indifference swim defense MICROARRAY R54 ppic delayed hydantoin A3741 pacl 177 US linn weller flat slime associated polyphasic oru workshop 205 bergey' modify adenyltransferase BCC0028 annexe CCGAAT deposition BCC1320 B2908 oosawa 00456 pierard increasing puld conversely B2233 esterase flank 0213 triphosphate outdated lysi preparation 041 curing sulfur insertion least 10929 GCCGTTGATCAGCAGGTT depending 0000749 house’ renamed ribosoma 1993 00001498 geraldo percentage 400 BCC0092 633 household introduction 1825 receiver fixed fairbank fridovich 1100E 45E PBS bevivino riccardi CT paper lundov 025008 000170 24266 last cytoplasm allergenic unilever 0165 000045 identity 1201 cdna’ update penetrability acidic hi stresse next TE 3300 sargasso innate GAAGAAAAT transaction withstand 110 methanol buhler toward value oral cyclase insoluble finding displacement contain overview F9 blended washed twelve dictate aspiration pete 646 negligible 00548 mchugh intended polymorphism fluorescent hit science specification LB ciche kioski CAAGCAGT nce BCC0475 company SEQUENCE anti make progressive B2926 A6 herrero industry quantified maintaining epidemiology passing 1587 input produkte veen phospholipase A3192 227 0003674 B2594 tip kinetic 00161 A3758 A6017 guglierame 264 AU0553 property utilization grew situ rat displayed calenbergh 2905 hakime transformation acti glutamate oklahoma secondary some applied 671 arrangement 2003b improm solubility function committee ayr 1kb catabolic somehow CLIN ghent processe promoter film pilu B11 methyl dowson R10 cate cy3™ 2431 580nm methylisothiazolinone 1945 B2852 A3235 constant REFERENCES fungorum minitab H4 morgenroth 1946 financial respect dutp 2276 A3239 non pearson against dendritic ethylenediaminetetraacetic 000182 regarded PFGE assimilating 00398 joining ultivoran CONTAMINATION inversely antiseptic failing cur1 location camara carefully biocide bilayer RESEARCH 27S B2884 0319 reliance engine ASSAY society BCC1310 label B0619 iodine hydratase IM benzisothiazolone chaplin coconut 00066 differentiated choline adherence ability diagnosi MATE agarose improve BCC1307 aspect holden lewenza rely likely phenylalanine competency mungall fourteen cunningham A5091 102 employed kasimoglu govan 037 threonine 00584 GCGT 1218 ceftazidime 000375 clone” 259 CGCCT detected undoubtedly unclassifie 163 hybridised rnaseout™ cepi incapable nitrate halpern aldrich positive friscina pritchard allantoin 0006090 fusion necessarily hammerschmidt alassiri silhavy BCC0276 0247 dimethylsulfoxide cunha BIOFILM analysing 00182 imidazolidynly kovach lipophillic variation und salgado B1429 A4671 substitution BCC8 rapidly philip accurate tillson YGGA fragmentation borovian sundin fap pope biosynthetic opcm motif com biofilm 00060625 remove circumvent helen cheung A0713 aeuriginosa inoculum display MHA clonal chloro amikacin extrude EU 15287 michiel salt IV calibrator C7095 249 cosmetic intense 0015 shift pmb1 hon ACAGAT sweden henry appose proximity cydye 385 decorate protease healthy diminish 0938 multifariou packaging GGG 0261 …………………………………… 479 847 heerklotz lag hybridisation C7455 import H10 loci 619 why product 000127 methionine 00407 irritancy eradicated consider oxon B1665 subcellular BCC1281 orbital banana 00586 rh interruption NAD break course trna behaviour CGAGCGT 377 variou “slippery claridge LB400 AIMS lower distorting comprising rosenow specific C4455 undissociated insecticide castro design 701 talcoct 0034 214 rozee methylbut internal studie 6622 000112 inhibition enolase pronase entner package ph8 colonisation barbe chlorinated appendage A3567 exporter american 768 pellicer ajluni G3 CATGTCGGTGTTTCCGTTC samoray CCAGCACGA zylstra roger 338 0476 unmodified 761 576 concept quenched diluting switzerland reiterated phosphoglycolate 484 1078 B1750 infect occurred contamination involved lashen united other C7537 factorial exploiting fungal sul significance BCC1287 328 worthy microbiologically rotisserie transient bioinformatic multiovoran term leggett assimilatable villemur oxford except quartz indicative jimenez university malfatti minimising morphological G5 630 principle permanently konstantinidi impermeability B12 10mm amplicon C6836 gervoviae competence another 0040 B0022 0050 target diesel view glydant 125 A5765 1188 0006063 formation deposited lipase 2008 flp ranging nonculturable entered discovered baden thermo clinically LIST hydrophobic 2007b nitrilotriacetic DUF805 milieu cephalosporin forest specificity 397 pase powerful microbiolgical manner homen CAGAA characterizing relie overcoming antiport A6485 1191 MJ GAGCACGG disrupt probing neighbouring neidhardt soft stres detachment morbidity XIV delgadillo opinion exodeoxyribonuclease GCCGCCCGACT 186 culture fnr curve B1918 permease commercial 14191 genetic washington ype 025 broth finland 0013 alkaline 1986 dissolving favour walter wray GE acyltransferase intermolecular 1551 broken partial necator NTA imidazolinyl bason insufficient 0150 00114 inadequate senc staining repeatedly winder increasingly allosteric naphthylamide well beck B2154 recent preventing B2208 G10 dorsey qach harbor conjugal chemistry potential australia newer 1875 hanlon sharp characteristically CGGTCGAGTAGTTGGTCTGG 297 GAAGCTCGCCGAACTCGT ASSESSING dockery 060 TAC 23254 fungu 00035 cellular peltier 00809 proteobacteria 00625 superoxide gspj mexb none D15 cycler nair tetraacetic pres CGAGGACNAGAT followed 0004494 phenylmercuric cationic BIT regulated pool catalytic linked phosphatidyltransferase optical hydrolase B7 GFX burkholder plasmid pharmacopeia establishing carr antagonistic CACG divided A5414 rocha indicating directed taber 00659 wider suitable donoghue B1042 so kieć surman C7110 INDUSTRIAL 283 perone 24068 156 6324 silica subjective capability syndrome’ avi 0198 SUMMARY 17828 messenger adham CCGCGT 000485 hospital sterile greatest 0486 marker autosomal straight 09375 early lux 00194 ASSAYS koonin conjugative santa manno 000133 trade 1042 00167 denyer DUF796 isle epsilon 196 air B2596 translocation GCC additionally 118 niche 2004b form 0023 para baby lau schreur loretz buultjen B2853 biospec bvii P3 92E BCC1321 synthesized give 2173 unique 00705 437 194 metabolised reye complementary competitor confirmation 03125 BCC1559 tailor defrosted equilibrium figure gravelle annual node being gutierrez constructed scanned analyser polymerase december possessed free’ examined 2160 00318 gardiner gaonkar schulke biofouling 226 microbiologica A6191 derived 527 AGGAGT man 25416 00170 steinbach haemagglutinin rela A4150 inhibitory 833 growth’ planktonically elucidate efflux flg mixe PHDC diagnostically possibly http B1005 B0374 differed 1999 sulfhydryl hauser twist may acidovoran copper medicinal hall different functional A4309 20358 coa A4991 B2297 emergence wilkinson CR008 B0371 polymorphorism attached spilker mid 00947 000465 A6361 burkholdena 2nd bcc169 novel additivity 950 BCC0764 00277 A6192 synergistic piperacillin dressing 1992 acetate C6545 pandoraea 4x44k thu 0101 saudi 80oc quarternium BCC1308 244 o'sullivan zervo 0212 regard butyl CELLS capsular epithelial bromide C7344 hard width toxicology discrete knock number 452 295 pigmentation 2001b overestimating error A3242 attempted 0184 surveyed organization MK peritoneal comparative ORNL bowker otp' dihdropyrimidime 17588 beal catheter 1628 MEX now davidson IG universal population 237 B2933 000100 test produce tn5 standardised resist biased 100 column 300 how proved cyanate identical event 001455 scanner EXTRACTION motile KD their 1407 0255 0097 retained scale mutant colonization best relating hoffman microdilution porcine presume malek blastn enterica therefore sussex C7345 oxygen deactivate having nasal phosphopyruvat 759 log10 slowly psf maturation included charlie interpretation 235 GAACCGAAA emission siderophore A5720 uridylylation rot 10ul question 265 296 B0088 oligosaccharide antibiotic 171 paramount 2001c A3236 polycation dibromodicyanobutane pressure loan microtube carried far dimmer lorian 51299 required suffix pea aquaticu 0121 magnesium bcc1296 CGACAT also mcbain 6572 GX tissue vu3695 multistate distribution related phosphodiesterase spike endogenously cancer 0137 but too centrifuged consequential folded over diehl cgmp bacteriostatic largely webb goor 11E seventh BCC1406 schematic A3634 acyl cepacia” criterion geographic FE B2900 induce contaminant dentify lata putrescine CCGCCAATACTGCGTCTG prevent 000037 2000b documented tendency exopolysachharide ABI epidemiological agar polymorphic UK BCC1318 assume beautify statistical goldberg correspond lysophospholipid matrix 0263 like 677 ranged IIIB C7294 18830 shot camp A5058 hydroxy contaminate A6102 pigmented A4545 polymixin mating complementation ornithine microcolonie A3560 km50 fund metallica subjected undertaken acknowledged especially automated include ha unlikely cut BCC0212 chelex bronopol polyketide 352 000914 evidence variably 126 activated ttp 18829 2803 CMIT limiting ordinate 176 alkanesulfonate footnote 256 bridging europe C7504 pathogen nodt glacial wigfield caused challi B0424 abolish qiaquick iodopropynyl chelate worldwide versatile SAM 500 sir virulence based thesi 1200 pollutant discusse ml fakihi pivotal cleavage serratia A5767 pare ST−122 1598 assigned genespring X100 A3515 molin residual jacob 394 kabara brackman architecture gentle chemische papaleo hertweck willem collagenase BCC0095 favourable sebaihia pyrrocinia harrison unnamed depend device 3173 extracted flgk unit B0355 fimbriae recessive CL kamiya priority made page 00111 enusa plating toluene designation bccm subtraction genetically periplasm field ESP fe3 secretin 001498 estimation 215 ACT 0329 A4500 such greater shape B0522 AU3556 heterogeneity wang played geftic degree MFP 00002 unaffected equivalent luria farnesyl transposon’ mobility DR dimerization 826 supplier phylogenetic current amber hilton A7 075 bcc1306 sulphur example container discussed chey 0063 exception sponsor uncharacterised grain amsterdam devescovi protoplast bigdye successfully nie E8 north familie aliphatic 937 GAGAC gomez GGCCGAGGCGGCGCGGCGCG assessed holme turbulent tenfold chamber member A3274 radstrom B0678 rad adjusting EAL 994 discrimination glycerine A5507 patch rlpb elevated economic bonapace microscope qaca time norri coenzyme round maintain evaluate terminase APPROVED murray 0153 SPFH serotype butylcarbamate A3568 A3865 cyclic ST−72 429 C7208 communitie 00124 C7587 00737 BA mic penicillin B1023 “sour routinely individually medrano human celled classical GGA precipitation 585 spark 000106 twice CGCGACGGT irani 1080 vacuum interfere participate 0270 JM109 contaminated diagram bacteremia matt yetman serie coupling hart washburn accustomed separately tan hydroxylating vortexed genomic methylisothiazolone scientific additive complex nuceolphile gent 00155 BCAM1945 30oc aviation A3783 A4539 nine cell modak closed transposition coated vergunt bridge methylchloro apparent ∑FIC pena GCAGCT ADP showed knockout microtire e45 270 FEMS 00366 filled international BCAL3515 largest bifunctional represent reaction deoxyribonucleotide upstream proliferation tomlin 2007 adenylylt signaling thermocycler dominant 00004681 peeter optimising lessie unpublished epidemiologist reason 740 inse element heeb receptor pag 103 TCG probe apart kobayashi dimethoxy achieve ST BCC0008 bottle domain production teran tn10 mcculloch generically BBSRC alert math chlorhexidine synergy 00297 potentiation PP lactate prigge proteolytic 750 sequester meter abgene bischof healthcare nowak hindlll mucin chloramphenicol CGCCGC inactive A4382 3H2O useful secretory mbp 00034 resin davie 0233 pollution alter updated coordinated nuclease B0106 10x throat tailed polissi A6230 reliably ara4n GMP mutase homolog continue grant 3the sufficiently consequence eisen band library weaknes 143 neolone IIIC identifying use transposoon C6818 stirrer isolate consortium phospholipid ethylhexyl publishing sputorum week 0196 despite stimulate 2914 until zhulin XVI AMMD 0367 384 basingstoke unreliable achievement diphosphate johnson LST hughe temperature CYG yve A3544 F3 arise davi confidence 0469 000772 therapy pine 12N2O4 microbiological kosako 57E dried BCC0169 opacity H12424 scott p2b bartlesville dispersing karatan keren poorer 261 0287 infective revisited aim tetracycline B0512 pigment charge suspended trinidad sickbert reverting BCC1289 A6000 streaked 0383 taiwan false biometal acta rare walli 1590 altering whilst 1652 essential typical CAGGCGGCT orthologou antigen nucleoside kaldalu subsequently replace establish GCCGCGCGGCT ice folia GAAGAAGTTGTGGCGAAGG nsport inan hume GCCGACCCGCGGACCAACT 0197 observed 282 hydrocarbon 1x108 420 clariant consuming growth thermu 4673 carbohydrate established CAGGGT pavel mean modifying numerou diego began via catalysing hillaert kit heated mesophile simultaneou kim barka regulatory donlan bactericidal conservation surveillance enthusiasm CGGCAT sensing LISTS scope B1961 A5936 harm biotechnology perform aromatic 42oc 1251 C7246 tetr enhancing caspari 5448 activation 879 releasing polycationic efficiency aging inc survivor range 2008b inactivation carrier portuguese biopesticide planet medium 62oc root 133 000674 fernandez rutala haemophilu A6297 00253152 particularly effect beta transmission histidine mexa tolerated stay 5017 pectate cation localised NNN search vancanneyt specie merchante exploit 32E ulopyranosylonic coli CFU 00250 ramette 166 turbidimetric A6482 ≥50 braza C6 intergenic D9 leazer 134 gain gill 0074 vented 1904 react CEPACIA GGT placing major greening GTCCTTGCGCAGCTTGTC BCC1309 place primary dongarra instruction comprised absent CTFA hypothesi above 1134 cep sgrl USA help GGGACCAGT BCC0198 combined 185 thin coded lerma play 00317 enhancer cytosine NTP reversible A12 pulg GTTGTGCGACGGGATTTC noise 127 cetrimidine lactam kuemmerle RFLP fanning recommend 1481 pseudomona chloroxylenol aminogylcoside outlier 050 ribopure™ aid migrate GGCCGAGACCAT clement 00613 mutagenesi withdrawal sulfate serve A6360 512 cable hydrolyse targeting harnes loughborough gil determinative 722 bypassing C6744 molecule tumour A6047 custom 0428 A3562 consistently regional hitchin reduce insight studied confer 23255 H2O milano 153 land 0335 zondag normalisation 00191 101 340 15th vitek cysb 35254 chromosomally activity outward ebi ubonensi 0211 B2823 dishe placed pinto kajimura presence urban BCC0044 faecali knight 0389 sargent viscosity setting fragrance goal unsurprising wale thank publicity type 285 2fe withheld motility trigger STRAINS herein quench transmissible detoxifie check context pepidoglycan reactive situation 569 credibility note CCCCT BCC0002 nature there bcc 01498 flanking eye 00151 explored glycogen market laminar guard chloromethylisothiazolinone 5821 mlstdbnet belspo 180 thiol montgomery B196 storz aliquoted ACCESS stepwise BCC0019 31E A4541 246 chemistrie south formerly tripeptide octulosonic partially checkerboard ghirardini 18821 abundance GGGGT aquifer bansal 1688 025314 measuring methylated acquisition methylparaben divergently certain B3063 barrel COG TSB 0157 coenye readily occur professional adaptability meeting edn varying directly amount SCIENTIFIC hubert quarternary boekel china CRITERION 2000a B0683 website enzymology CONCLUSIONS 3343 unles API citrate 0459 moreira multihost confirmed 116 136 systematically inter propanol few 1580 qiagen rejected GCGGCGCGT horsforth revet assimilatory 29352 reverse mentor dh2o york occasionally swabbed 0003249 001 microplate killing contact 00904 speert should 000449 discus 301 RP4 PREVIOUSLY 456 045 calculated D12 C3 selected concatenated merr disulfur predominant predominantly applying N2 1539 generalised cloacae quantification notl bur94 biorad CD liquid river bar fine 366 chiarini C4H5NOS neutralisation 3527 B1919 570m interest dangerou barcelona 00015 mexxy cue leclercq 38E frequently immunocompetent 888 assimilable researcher poor permeation undesirable CCAGAT GSH incubated 5457 phosphate resulting CGCT 349 newcastle clinical 0162 E3 screened BCCM recipient chopra build diluted levison GCGCA 63E coefficient norfloxacin 0173 137 1414 harvest index inorganic multidrug 666 transaldolase ≤80 lactone isomerase BCAM aminopeptidase proposed AMP B1863 off FLP confound reproductive chorismate NH2 heo known ketol DOT lipa A5145 323 inoculate TCE switching dicarboxylate 000364 formaldhyde additional 187 phytanoyl subpopulation brinkman 0435 molinaro 005 BCC1603 B1467 assumption norm vivo city GGCGAT 212 00150 dynamically person repressed maintenance stibitz biomedical reporting BCC1288 microbistatic actinobacillu kingdom tolietrie agnoli PII interact GCT evan lipid electrophoretic intubated straetman degrader fungi seawater slide 046875 seminar methodologie heterogeneou 16232 winsor maddison runge ethylhexylglcerin line CHEMICALS boghossian similarity ethylenediamine pickettii A5413 108 604 fisher 477 result luxr 330 synthesise biology genome registration solution alpha reflecting text 0178 00105 stated mraw house dnase haemaglutinin 000094 concurrently sourced biochemical prba gov BCC1191 detail skurray ‘phoenix parson 449 favero disc ET ceased 1579 ehrenreich BCC1299 need INDUSTRY lplt persist 375 artefact interface fatty fondi gelzer 0010 NOR DERIVED romling 0235 ethyl 0051 suggesting per outside validated performed interval deox fewer ET12 furukawa subunit quinn 155 0004312 interaction young 626 RAPD dipeptide center lyase peptidyl hertfordshire excipient bcc0072 biocidal abolished cepacia physical gel 257 B1832 decipher swa withstanding aeruginosa working amplification tobramycin 0118 TRANSPOSON microbiology activator metabolism cyanine inhibit B0192 A4203 cleaning sensitive biophysical incubation difficult indicated HSL manoil distinguishing pubmlst 520 taha 006 nipagin prefabricated MBR manufactured hydrolyzing power tiedje code gergoviae period although substance rtion BCC0474 claim clustered important old campanelli hypersusceptiblity 00133 175 3307 ≥28 lysr comparison jensen GOG CCACCG all 665 2827 ‘paraben dinucleotide bcc0305 balkhy B2149 redox british GC eberl mucoid subspecie 930 B0672 BCC0479 indeterminate” degradation FDH 2006 0248 imipenem adaptation gomeza methyltransferase 081 arg 198 horrock pairwise nanodrop argentina primer hotta red drastically transported 00241 solvent 913 SE retief exchangeable oprm relate ribonucleic characterising 000456 H2 lactamase 361 202 total flexigene ecosystem development 000243 limitation candida A4383 1984 support add flagellum phenazine C7H5NOS hydroxphenylacetate 307 BCC1315 C7543 A5329 factor B1007 154 petroleum potent 000145 swell indirectly including control 0366 000075 A3558 almawi indwelling created malignancy surgical benzethonium PMX fearnside upton february 2715 complete portion itself depolymerase mapping BCC1554 554 microtitre minitransposon content RND hancock SAR metalloendopeptidase multireplicon mostly pled chilled alte rahi microbiologist 890 gallego pathology stain berkshire 299 0237 localisation C6816 A3275 permeable DTT negative spheroplast historic boston H8 transport wood discrepancy clal disrupted structured moody imparting metabolic html 0303 1976 geographical create below lecithin during 0172 similaritie rtpcr altered LMG22485 bolla TTG lorenzo frozen encountered superfamilie 229 annealing ministry greatly multiple shaped critically A5274 A6103 nebulization A4704 B2478 DH5α BCC1395 grade 315 mystery chosen penetylene cy5 equally vandamme amplified 1947 mcdonald 1347 viruse BCC1305 ≥18M recently solubilising duration lefebre CGGCAGCGGCGT AU1054 zachariae covalently heparin 0189 resolution fixing handzlik B1981 GGCGCGGCT encompassed basi signalling writing yano collier trait C7691 decreasing homologou lipoic AHL IIIA specify MWG leaching A3313 disaccharide environment 317 batch segura romero distributed goldstein plural biomolecular cha proctor appendix austin ANOVA groundwater distinction formaldehyde 1007 HAE1 relative 1186 clustering CTTGTCCTTCTTTGCCTTCG 0351 A5004 PTC IT open lepine 96oc 529 significant cystine USP dissimilar extended importantly multidisciplinary characterization neutral mobile dell contained tagging replica bcc1406 MOTILITY ppm KO covent CGCCGT BCC1409 inclusion BCC1560 BCC0639 attributed demonstrating morton alternatively aminotransferase 1340 G4140 247 cultivation 3927 designed 289 predict extraction post recombinase easily shared 00643 0000112 abiotic subtle “background pomorski alkylquinoline legislation akiyama inducible 147 ethene kumar induced 1291 GCCCT A3 whiteside assayed secretion pooled slope mulvey 00005 bioremediator connection they listening 000653 czech lidstrom M55 cellulase CGGT oxide johnston monosaccharide VAN inhibitor staphylococcu adverse levofloxacin GACT conferred 1406 B1715 jenal meirinho B1000 atlantic genu 117 A3545 clustalw B1911 tat acrb 0009 micro evolving validation CONTENTS freedman B1497 denaturing removal BCC0022 attribute 821 696 producer summarise allenza annex clinic fingertip 094 weak phd serial according region bolism BCC0027 contributing arranged aggregation C7548 sour cycle c8h9cln2o2s2 fita NS putatively predicted statically A5803 antibacterial digestion 2178 showing swedberg 0489 coopman A3513 hydroxyl 210 filter suggest 0241 staff colonial release inhibiting hydrochloric promotion B2934 defining roja carrying manufacturer coll 00205 phenoxetol 0267 banding A4993 2920 media matched 00143 OH plos dihydropyrimidine ofrela submitted FDA mrna consisting clean main laeven pharmacologist classification summarised quorum harrington 271 plantari basic 1024 colour bollet quantifying AWARDS pha influx hybridising C7123 drive interior blue alternative dickinson pyrophosphokinase distinguish advice bacteriology saved 05E K2HPO4 kunisawa 000120 paulsen dandruff mistaken lung acces doherty excellent protein leakage newly polysaccharide mcdonnell lonza maltophilia airway multi dilution cage 242 C6717 00412 date concerned opening simon median buy implication martin unacceptable matrician conventional mechanistically life speculative extend mandelate prohibit tested subject SDS ……………………………… lai marketing 0135 yeast section2 arevalo energy roche expres intrinsic system figurski penetration month caprylyl 1296 0381 2161 braoudaki pragmatic greenwood B2365 D11 bertani ingres ON every polyamine ttg datp intermediate subtili BCC1316 ssur 014 corey oak franci petri AAGAAT 18822 002 leveau isolated dimethyl model 13E A5887 national controversial 739 norville pmol BCC0338 monooxygenase addition shampoo 135 NIC spalding facilitie 145 ramon vick arginine tranporter formally risk gillespie chevalier sobh nucleotidyltransferase amino 00126576 vgr encoded assurance brand BCC1298 care wilmot accommodate addressed intrinsically ulrich CAGCT klontz poorly carboxylase bracket BCC1306 soilborne 1015 heat acidification abnormally 4oc notification inhibited formular exported pyochelin oxygenase C7497 slow phosphorylated highly quile B1260 743 agullo italian unidentified 70oc similarly soil ignore simplistic apricot map HB101 ursing PA measured inner strictly COO benefit AZM beside arbori study 1040 duque affect chemotherapy fundamental metabolise survive C6622 supervisor proposition 0145 injury family isosensitest patatin 152 neli 342 california 862 341 case karimpour vac plasposon hebbar laten reportedly mouth harvesting rossum slight 0327 rice midwest ago tkachenko observation pnl encompassing effectively surface facing labelled ait H5 octulosonate pharmaceutical bioline about down 0492 GCACGCGT CIP 000749 'omics' BCC1421 metabolite BLAST 120 taylor defined characterisation crude fluorescence amine 00675 hinder stressed hentzer 254 iwanicka prove calcium DUF81 DDH inappropriate PET 65oc caprylic millilitre tripartite denatured kruskal benzalkonium STRAIN ttg2abc 1987 kainer 4920 reputation toxic S10 bonfield sulphate GAACAT transitory smelling 399 matlow together heymann 0151 PRK2013 unreacted 436 213 originate M20D metalloenzyme B9 0458 lipoprotein 47E C6876 animal CAGT unusual formed changing A3369 transcriptomic normal cold 386 akkad technical 008 lesser opaque 200 convey biogenesi pmx120 own BSM 383CMIT A6101 zlosnik 161 arrayexpres mex buroni cognate regulating 109 2003a 21775 A3863 spore monitoring endonuclease regulator gylcero improved C6656 BCC posttranslational utilizing seminali TABLE purple B1677 000664 P1 costly english XVII boyer 000367 2797 bacteraemia trka estrogenic representing utilise B2299 FIC hydrated atpd christiansen transportation art wound 0103 7160 racemase promega truly 15280 PH varied eradication tp20 0337 yield protective marketed compant clas DM 3121 excinuclease understood characterise fractional bae 0179 digitalised 3427 0471 competing sall resolved active CTAB B2862 A3561 daoud 1470 CGAGAT GCCGCACG glucose schmittgen thick accounting impact B0225 formulation 00379 00146 evident examine octo paraben achieved glycol reciever vitamin random run manufacturing 2100 photocopying 1006 29E reappeared capsule reservoir liu guideline A3244 oil GGC 629 washcloth 4915 assimilation barlow ranscription prevalence distance 000488 lysate ikedo C2 disinfection destructive AAGCGTTCGACAAGGTCAAG currently menon remington 0039 complementing xbal sas C7479 BCC1401 layer partitioning opened rnd 00121 BCC1295 detection successive B3016 added ineffective channel collection deionised beteli face flippase A4439 fluorescen home dehydration revealed CLSI movement provided electrophillic modulation couple plug large japanese replicon proceed removed gltd relatively der 322 GGCT attempt modulator physically bcc1313 A4384 B1977 ptnmodo 0450 pilin phac 0156 legend EXPERIMENTS chemical 6866 C10 acquire treatment DUF1316 abdel caucasian strain gathered hemolysin accuracy 10741 separated damage APPLICATION 0491 2908 manina B0213 B1025 catalyst bisguanide salmonella spine long otp’ hospitalized propyl chitinase fulfilment chaperone O2 determine force A5373 murga 00873 A4268 HEP anhydrase reagent suppl measure methylate 000606 initial become 00162 phenomenon sneath fra monitored ethylene pnom fehlner took penicillium J2315 21768 kerster xhol autotransporter category central saline presentation history A5884 entering letter 87E 0002812 B1913 19182 observing perfume consideration discovery 316 yate tion synthesising destabilise 1738 tryptone AAG GTG ≥70 CGGCGT 00144 several burkholderia 511 propertie INHIBITION PROFILING AAGCAGCCCGAGGA rinse adam DATA outbreak repressor 0436 ACAGCCCCGGCGCGACG CGACGT phage transcription levy somvanshi alibert ligation 1979 generation zhanel 1948 lead aquatic NTCC microorganism B1443 16659 watnick A3269 PRODUCTS plate baseline feature 00121250 approximate might stabilisation 1113 translocase “calibrator” 957 campbell impacting tend chhabra 00267 bcc1294 nipacide prof PRESERVATVIVE prolonged stable mechanism welfare pyrophosphate scenario treat 502 314 corresponding whose council CAT B1002 glycerophosphoryl AGAINST 5339 taguchi sputum autoclaved peptone oyaizu 1252 classically D4 water cardiff 12O3 A6115 BCC0446 ott cepri F5 challenging GENE bacteria started coagulation 195 conserved 2005 ribosome salicylate moderate differentially america ultrasound collaboration xenobiotic mucou sheltered 1241 clinincal engineering encourage mahenthiralingam C7206 A3343 0005243 deformylase slowed maloy second lesion mechanical scheme dttp eradicate arabia welch bound ISO skill lactonizing transduction love nov histone lambert olc moisturizing gilbert sterility 1222 piddock allowable C11H24O3 SWARMING reported intricate 174 0081 00296 A5963 vitro waine chew randomised mature refinement work AU6735 biotic ringed 52 cleanse statistic 302 smr unclassified cros indicator causative permeability 0004554 naturally 593 29170 188 TGC fraenkel coding 402 A4148 construct 6000 neutraliser tolerance SD conducted linkage A3576 abnormal candidature schweizer dismutase A4521 emerged 0279 whether 0060 grkovic groundbreaking biologically pro three ABC guidance 000677 weakest electrohillic preprocessed GGACGGCA affinity reflective ser80 ayala copie 464 reference electron 2011 oligonucleotide specifically penetrate phosphosphate 36oc activitie B0664 mix valde vapour BCC0023 harvested ADAPTED prediction substratum VU3695 mathematical wisdom librarie adair two metagenome B1496 arbitrary C8H8O3 exhibiting 1930 muzyka XI count each 298 0028 glycolysi gotschlich CGGCT B0443 ito 243 TCS churcher wish circuit acra wherea beater role promise exposing B1929 reductase sulbutamol B2939 technique 2008a bioanalyser nomenclature combat immunodominant LS BACTERIA bia 106 dia thailandensi qace∆1 0203 attachment 203 asses attention it 067 tolc comprise minor A6316 8942 1023 00444 cy5™ 0488 atc DGC mixed 656 2921 B1331 pili TGTTCCTGATCCCCGTATTC phenomenon’ weight phosphohydrolase A5935 339 discover BCC0322 228 268 45S stock full identification valdez whereby persister finished krieg giese half schwage searched DMSO efficient 121 sorbic oliver melero close exceptionally contam 487 belonging superfamiliy CONFERENCES cycling limit 3333 00262 ≤256 available 238 doubt drawn A4 448 covalent approved biochimica enacyloxin tn5mod block MFS A5942 ENVIRONMENTAL BCC0072 however detecting testing accompanied reversion dena gonzalez 48E grow double zielak 17616 B1912 italy dermosoft sum neutralised consequently determinant confidential bead 713 udine tolerant GCN5 intergron 14071 output 'kathon' accession jounal propylene valuable one hwan ortholog gaylarde thickett 00189 B2213 0405 synonymou outer minimum stimulu crp 0000375 palleroni bootstrap brief mcclean array METHODS incorporated module prepare 631 FMN A5349 7749 396 13010 efficiencie serine 482 allowed doudoroff site 'where 00944 robert ACG recalcitrant manipulation institution outlined year organochemical ultra knobel 1047 conway bicarbonate SCO1 gutheil BCC1408 00389 B0296 4121 multichromosomal laboratory informa assignment bioburden environmental 000066 dejsirilert among outgroup ptnmod 450 considered carthew influenza C9 ALIGNMENT A4990 GCCCGAGT ecologically murphy moist sokol correlated promoted ange CDS worst 097 hareland 00004 000750 auxotrophy ketchell A3514 GTP approval 146 kanamycin uridylyl MPR 356 CGCGGAGAAAC abbreviated A5481 chan 164 directive engledow onb kredich marx 8938 pseudopillin 0063281 lpte sequential dual 0019 SH thousand methyliosthiazolione conductance light enteritidi 454 perhap aw0 biodeterioration interacting virulent listed title debri quinol anecdote rule prober objective still 00147 direction lethal ga B1327 will wilken 5x105 65o glycine 325 PMT provoked infected storey skin ammonium compound A3746 harbour pascoe 211 cytochrome remarkably average loughlin nicola 00682 sterilization CGCATGAAGTTCGTGTTCAG network otal 389 pediatric accounted inverted badia gpa future complementory quite sample cause 00037462 very PERSONAL maize 218 infection esh B2300 00354 vertical genotyping acker A4739 usually 000084 016 tricloroethylene macrolide inoculating protozoa internally requiring omitting problem gluconic triplicate enterobacteriaceae A3949 antisepsi expertise CACT B1798 ttg2 hensel cultivated warrant avoid produced 160 00573 T2S signed walker 1048 component dry became bacterium 00141 popular boldly staden warm owe 3224 69E strip thereby parkhill 410 traffic weber qace disparate 999 miniature HAQ chemotaxi eubacteria adhesion gaca partition equipment biopharmaceutic B0668 189 pbr III nieto invitrogen wollmann fsel putative denoting 107 indeed dedicated locally demand journal coso4 ratio NCBI diester STAS 221 escherichia 417 0020 CGACT stopped recovered 00369 then dominated typed storage 00514 segment 2798 biotechnique highlighted oie blackwell 000303125 converted hoban A5212 removing pharmaceutic ring mah A5210 polymyxin merrick lonzagard vietnamiensi 373 direct CGGGACGGT interference hydrolysed G9 deficiency 1247 urinary BCC1297 16S iso gacs phenotypic “specie GT instructed znso4 conferring 95oc connected 5352 columbia hook swarming 0359 involving lnno deziel chapalain feasible haemophillu antagonised multifactorial ci 000401 TAAACGTATGGTCCGCATTC formula thermal BCC1294 A3518 alkylating horizontal enabled horizon due consequent regression neutralising powell 0054 collected halved sun analyzing seger annotated 151 reclassified increased skin” sessile six 1952 000625 287 poff 475 independent 000124 fructose hugo actinomycetemcomitan quality 138 nitrite polyhydroxyalkanoate valvano 012504 food mercuric often unrelated intensity reflect versatility raw 0155 nitrocellulose nikaido wassmann 029 differentiate decline daily restricted nsil similar constitutive indice 333 1995 combine sensiva liverpool B50 summer evaluated 7149 oxidoreductase revival deho CMIT1 supplie 12all described A4832 peroxidise BCC0742 B0540 5942 indicate same belgian reporter slower dispensed believed named free vertically B1428 ompa IMP rich tremblay B1861 tra VAN01 operate locu C6H9NO6 ACCAGCACGAGAAGAAGC discriminative 00821 proces regeneration BCAM1946 0169 RT evolution CCT deoxy allow capric hour AGACGC ‘long 0369 MIT larger stringent tool biophysica ICN 255 oxidise GAAGCCCGCCT ramo transition poole 182 azaleucine sector ftsh B1872 GCGCT optimum oxidative erroneou gelcompar acinetobacter PREPARATION here rhizosphere lancet phosphoryl 167 BCAL0577 rigg spanning 0250 jame butylparaben emollient taxon spot kreuzer spread 45oc 510 expressed antioxidant multiresistance 274 0242 given ensure 600nm yet acetonitrile hfq C7073 A8 unwavering 001563 SPECIES analysi 250 bind carbonic 0194 fletcher chain rack deterioration reynold separate official biophysic labsystem 130 cloete BOX klapper littlejohn BCC4 BACTERIAL aliquot article GCCGAAGGACT 0945 link feed oluene between FAD 00004683 lyman complement BCC0560 space testament F11 832 heating B1177 B2324 determining flagellar 00230 276 BCAL0576 parallel toxin 1831 put passage lawn 3mm martz bisphenol clin 20980 pore maclusky pelleted fail acceptable B2902 phenyethyl 7500 sousa rbohydrate delta aforementioned expert cryptic radomski “helper” B0175 opportunitie incident attack BCC0286 unexplored influenced 347 hydrophobe buffer filtered sized schubert 3165 ligand stalon enable etagenomic sodb galactarate axi 689 3129 maccos dose extract 1116 sensory atmospheric motive jin fuel thought validly les trial wandersman 001500 offer mixture andrea kill 727 T1E cunin saturated 96E dramatic breathe hydroxyphenylacetic TO cotter transferred 2010 renowned gmp fani presumably givskov abbreviation publication 140 B2218 genotypic www exces electrophoresi 00248 adequate doe thermofisher detrimental BCC1411 0500 scavenged gay verify public tp’ ingredient schirmer 12903 abundant B0083 chauhan fully exhibited “epidemic” B1906 B0686 entry jonsson children saez A5515 BCC1324 quenching BCC0020 modular quaternary day B0688 00500 6015 0219 determination 240 ABBREVIATIONS memish 00018731 viti sulhydryl 230 william exceeding 115 lowered “or gylcerin commercially C6627 C7559 UTP reik reflected transposase BCC0272 plated tigecycline must propionyl 0423 chea glycerol tri 0202 CCGCGAAGGT 000150 energetic griffith tn∆ eleven body neighbour 1990b able washing hwang rrupted 1mm rnase 1967 phosphotransferase using morgan single signal crawford A6132 resuspending BCC0195 advantage since optimisation labelling critical endemicity gap 20NE dalmastri AAGCT dehydrogenase comb 1996 0377 24065 dcw formulated 00437 sstl sham SXT ‘no thermotoga CACGCT B2598 signature scan bow 0268 B1001 venter cultured ever dhir 239 122 bcc0005 peptide fuqua 269 normally 363 emiliani 62E 000418 dispersal endoprotease fourth intact consumer appeared upper hinton temporal ramsey kachlany 000163 maiden E10 nucleic innately C7633 A3511 RAPEX amplify waigh firstly sicily kotsonist clarke encouraging AC compare literature gamble PRESERVATION clearly fleming CGCGT 0387 522 1632 2H2O lost 667 00388 nagamatsu decomposition B1722 BCC0476 29177 mnso4 BCC1296 H111 scanning limited unable thomson C10H A3342 ttg2b 00270 exceeded versu nano rrna integral acetyltransferaseisoleucine suffered auxotroph definitive malate within pchb prevalent obtained 00971 colleague phenotypically o'toole led biosynthesised actively organoletpic PROJECT rinidad reactivity buckinghamshire ATP organised yabuuchi obtain somewhat 1919 B2147 00016 stream carpentieri 0007 enterobacter CACGGCCGCACGCGGCT A4920 thiosulphate philosophiae enhanced exoprotein proceeding A3240 2004 B1568 BCC0004 alteration peterson UPGMA triparental ghazal 9284E generate 0325 culturable processing select ≤595 drevinek response domestic 083 regulon CAGCGCCGCCAG maique PBP 1st batche enriched because forstner luminescence sythase condition inocula 455 steinberg native decorosi liao machinery travel S33 e110 flic A5590 glycerin 0134 variance BAR eternally homologue altogether tyler cy3 adenine bank decade level tabor pathogenesi coupled train resistant evolutionary friend mer garden supplemented oxoacyl smaller 958 illustra ANTIMICROBIAL 18825 592 occurring bull BCC1207 1978 nmr stranded themselve 173 B2186 arac antagonist A3637 agilent 00912 palmata haematological bioscience carludovica mawer klebsiella fard displaying potentiator biochimie venn frequency B0681 383BC extracting historically AMPLIFIED ction CAAGGACGT cyscribe byrne A5808 0439 napthylamide peptidoglycan triple annal 1949 nh4cl kinase amin 19467 orientation ascl varie decrease crossman confirm 219 ATGAACGTGCTCCACAGTCC chromosome slightly isothiazolinone 00465 ACAT empty experimental BCC1303 equal friedrich cluster retardation oven heteropolysaccharide pasca II kda CGTACTTCCCGCTCGTCTAC parental broad CDEFGHIJKLMN stopping divalent delivery BC 206 vary 358 longer 737 B1771 BCC5 A4646 survival creeping GCGG giovannetti CHAPTER A4255 tribute originally them optimal 220 MP ethanolamine urwin mudaimeegh anthina uridyltransferase used farrington expanding story microengineering ferric 00269 gorg nor considerable BCAM1947 B0028 EP gorie A5209 when responsible emr C7396 background categorised functioning necessitate 0021 000210 7H2O 5667 CAAAT reached 00038 costerton alvarez A6333 0002718 moratorium acetylglutamate mgso4 CGAAC adenylyltransferase nsertion visually proposal challenge ambion translation lipoyl leistershire disruption 16670 plu re 933 autoclave analogue incorporating biotechnological 00102 drying explore XIII hydroxybenzoate pstl enforcement B1869 CHL bcc0169 transporter QAC annotation melting 993 otherwise christensen mucu advent phosphorylation reveal noble moving cdna 00018725 denaturation hence conduct bosso 000123 GAT andersson grouped 0011 ransferase integron served host 000352 weaken 0465 depletion sanger periplasmic initiating muconate solid europa mode sstrain BCC1293 secure 00264 richardson gp33 324 ‘in GGCACGAT further tulli mounted brock disrupting base colony regulat trafficking change dioxygenase revolution B1004 aldehyde outermost 1639 33E BCAL1756 phosphogylcolate developing ptnmodotp’ BCC1284 EDTA randomly arvest summary arduino B1355 influence called degrade bcc1323 C7251 institute bcc1283 visualised B2212 originating sessility initially consisted 312 000411 ecorv questionable fasi mueller adjacent beneficial CGAGAAGC statu regulation step mesh quaternum inoculated gltb 3115 pratten qrt 965 00408 specialised microtiter 800 burnie revision typing homology 4469 TCC diazolidinyl B1873 trimethyl 0005 administration FIGURES suitability 607 16srrna antimicrobial transferase bioedit phenol ceoab sajjan unknown toiletrie dosselaere 1073 machine elict colipa 00253 048 adjusted electrophilic capacity diphosphorylase denote leaflet 92248E point A6455 hand minority 3112 ion C7201 16654 performance A6478 fialho 00118 gained sulfite 022 73E AU0645 autoinducer wilt trimethoprim JW13 flow martinez bulb bacterial 0002549 compliance 028 CGAT A3419 avoiding B2417 ribosomal huang B2410 000 twin B1733 specified cytometry pull spectrophotometrically shaking translate diagnostic orir cox 015 A3375 membrane weakly macrorestriction 718 therapeutic small G11 AGAACATCCAGGTCGTGTCC A4968 speculation briefly found johansen BCC0030 diverse phosphoadenosine 275 phytopathogenic association B1915 complimentary 197 35S visible 1731 drlica elicit 853 dichlorocarbanilide reasurin discoverie 00403 overshadowed B1475 GA wopperer nodulating swal exposed reading ozone 00158 EEC carboxypeptidase 3517 holroyd canadian szomolay B2325 former 0243 perfumery cbl potassium repeated BMC expiry 0127 malik C7477 sandegren ethylhexylglycerin nowicka 1690 dettmar lysine training 000502 cocci phenylacetic turbid gmbh plant 00291 low glutathione allele kothe CGACGCCGCGCGCCGCA pure extension 251 daston 369 phasin 00065 SLC6 through 0304 succes while patche casamino modification revert phosphotyrosine A9 paul C7H 00128 oxidation clear gene dekimpe TTTCTGGGCTTTCGATGATG take BCC0001 breakthrough panlilio tellurite hyl zinc wachenfeldt 00009 BCC1326 1682 A6244 0309 screening developed RANDOM 14n2na2o8 minute impossible dougla fluoroquinolone MICROBIAL heidelberg fritsche transcriptase 17084 xylulose ONE linear glucosidase 2315 tymphimurium irrespective photorhabdu morphology 00427 2257 forum dipetide povidine enterococcu 514 noise” 0477 branche ≥60 generalized transfer formal priming school deletion B1047 000056 visualisation allelic maintained 1994 altp 0409 DUF485 suffer finally posses 1175 sparfloxacin haa 17997 0154 norderstedt transposon vliet read utilised 0349 surrounding once peason killed 01000 centrifugation translated B0937 paint mil 0018 thiamine 0031 snap 000877 BCC0171 150 GCCGGCT absorbance strategy 245 purpose DUF6 cepacian enyl persistent MUTAGENESIS cerdeno 00152 spel superscript™ B1364 B2 zirconia reca TSA dimer 98oc 18835 inherent decreased accumulation flipped timmi present republic spermidine minimal riley gaille bodie 1410 floor facilitating BCC1282 see BCC1430 ional oprd tenth preserve analysed stoodley pose susceptibility isolation dissipating 368 constitutively BCC0021 approximatley honeybourne joined interrupted 0107 mediate 00506 dynex “eugenic albuterol 12981 oliveira lomovskaya biphenyl chistoserdova 208 LATA IC 292 acros exhibit 291 C7402 version fermenter moisturising common difficultie either 114 porin designated detect health arrigo homocysteine AU1075 simplicity BCC1325 harding throughout toxoflavin gpsa discarded aureu review 241 restore 0201 reeve cheng 327 industrie 1970 relatednes 088 00129 CHANGE polychlorinated gradually nebuliser lao can't prognosi ATCC carboxylate xenovoran BCC1304 stably interpreted ∆CT 104 general disinfectant maximum fitnes cherevach o’sullivan enterbacter noticed 0067 BBC cloned haye restrict 56E 1513 BR000 aguilar 001000 authorised lb400 flexible 747 beveridge 159 A5858 121oc five chelating stipulate 054 dilute 0418 GCG 94oc EFFLUX 4217 1017 closer stricter kawamura PDA 55E 0403 PIP A3289 confluent riddle gently 5815 BCC1555 162 defect academy prepared dimethol 012 sanitation list 1912 out soare 986 promptly yang germany feso4 shielding modified deuridylylation MLST 201 turnover karlowsky HME stavri core massive stage ACACCGCGT B0278 consensu viability GGCCGAGCGGG simplest 266 hydrolysi consist section 000189 size impedance nucleotidase enumerated sodc fabi BCC1412 dimethyol ambifaria proton 00636 discriminatory plasticity kavari side belitsky 16660 exogenou 910 CGCCGACGGGACGT taxonomic 693 street ttg2a MEXP CAZ exponential rubio horizontally mexr rnasin aggregated terminated blank interlaboratory NADPH pump expense PREVENTING organisation enough social schofield 0208 prolific 0911 BCC0810 adenosyl polyhyfroxubutyrate B2185 bentley completely occupying PCR oxoid safety acid elevate short gold physiological S2 ACCTGATCAAGCTGCTCACC utilising j2315 0026 sanderson poster flagella APPENDICES B1028 STDEV retain zelenitsky hypermutation benzoate A5677 resultant F12 411 barrell 169 catalyse COMPLEX azithromycin inadequately fiance 398 insert 000303 encode oxidising majority egres H9 taq reil 190 carry FUTURE name boaisha lytic instance 231 9929 JGI bioscreen mannitolytica tube phytopathology comparitive EG basel transpositional nursing rotated involvement 00345 detergent PT NB reproducibility 1966 investigation degradative conjunction osmotic steven reside GEX postgraduate correction biodisk atpase fixative albican shintre physiochemical A3772 protocol bioengineered hailand require terrada A4992 peroxidase A3512 requirement valkova metallophosphoesterase 924 catabolism precursor 00213 synthesised contribution BCC1314 emended head barreto sister ligase B2109 nielsen matthew B1770 bcc1291 0188 CCGGACGT GGCACCGT 172 burn goodhead starting A4647 223 CACGAT anderson RESPONSE cream 639 turbidometric branched interestingly quinolone sensivia fingerprinting highest C7542 morr immune DERIVATIVES 216 biodegradable ubiquitou longo denisty avoided phenomena C6591 along cannot binding not meta CPC VIII luminometer 21824 mark 2928 filtering brown tpr 1794 0315 fur companie spectrum enzymatic 277 A4956 strict heid remain hydroxyacid hybridization division quarter drop A5900 transcript ridge detoxify 00097 uptake selection UV daniel phenylethanol 123 304 PRESERVATIVE severe 0004365 reduced repair triclosan polymxyin remained live cupriavidu arsenal counter ENVI gluconate lee standard isogenic 093 multicellular GCCT community pair hindered mayr before 403 B1979 replication exopolysaccharide gylcerophospholipd 0171 C7150 gluthione cetylpyridinium CFTA vesicular barrier implicated AGG room gaining anion high availability 0006 demonstrated ethylisothiazolinone masi A5849 colonie viz first ROS B0084 marchbank 78E e17 lysed overall 37oc 1985 sub candidate biopesticidal structure heinz exponent racheotomy 2003